balazsi g (Addgene inc)
Addgene inc is a verified supplier 
91
Structured Review
Addgene inc
balazsi g
Balazsi G, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid/pDN-D2irTN2AG5kwh+(Plasmid+%23128253)/pm42926929-191-9-11
Average 91 stars, based on 4 article reviews
Balazsi G, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid/pDN-D2irTN2AG5kwh+(Plasmid+%23128253)/pm42926929-191-9-11
Average 91 stars, based on 4 article reviews
balazsi g - by Bioz Stars,
2026-11
91/100 stars
Images
Related Articles
Expressing:Article Title: Local gene editing of fibroblasts in tumors reveals a new cancer-associated fibroblast state Article Snippet: .. To generate NIH/3T3 cells expressing Cas9 (NIH/3T3.Cas9.EGFP), NIH/3T3 cells were lentivirally transduced with the viral supernatant produced in Lenti-X 293T cells after transfection with the following plasmids: cargo plasmid containing Cas9 and EGFP (pL-CRISPR.EFS-GFP, #57818; Addgene), VSV-G envelope–containing Transduction:Article Title: Local gene editing of fibroblasts in tumors reveals a new cancer-associated fibroblast state Article Snippet: .. To generate NIH/3T3 cells expressing Cas9 (NIH/3T3.Cas9.EGFP), NIH/3T3 cells were lentivirally transduced with the viral supernatant produced in Lenti-X 293T cells after transfection with the following plasmids: cargo plasmid containing Cas9 and EGFP (pL-CRISPR.EFS-GFP, #57818; Addgene), VSV-G envelope–containing Produced:Article Title: Local gene editing of fibroblasts in tumors reveals a new cancer-associated fibroblast state Article Snippet: .. To generate NIH/3T3 cells expressing Cas9 (NIH/3T3.Cas9.EGFP), NIH/3T3 cells were lentivirally transduced with the viral supernatant produced in Lenti-X 293T cells after transfection with the following plasmids: cargo plasmid containing Cas9 and EGFP (pL-CRISPR.EFS-GFP, #57818; Addgene), VSV-G envelope–containing Transfection:Article Title: Local gene editing of fibroblasts in tumors reveals a new cancer-associated fibroblast state Article Snippet: .. To generate NIH/3T3 cells expressing Cas9 (NIH/3T3.Cas9.EGFP), NIH/3T3 cells were lentivirally transduced with the viral supernatant produced in Lenti-X 293T cells after transfection with the following plasmids: cargo plasmid containing Cas9 and EGFP (pL-CRISPR.EFS-GFP, #57818; Addgene), VSV-G envelope–containing Article Title: Engineered human Argonaute 2 for targeted C-to-U RNA base editing. Article Snippet: .. On day 1, cells were transfected with jetPRIME transfection reagent in a transfection mixture containing 2 μg of plasmid, 0.2 μg of Sleeping Article Title: Adult-onset deficiency of β-klotho in the liver reveals a novel role in lipid homeostasis. Article Snippet: 402 403 4.2 Adeno-associated virus generation 404 Expression cassettes encoding sgRNA sequences targeting exon 1 of Klb (sgRNA1: 405 TTACCGGCTTCTCCGGAGAC, sgRNA2: TAAAAAACAGTACGTGAGTC, sgRNA3: 406 TGCTCCGGTCCCAACGCCCC) and targeting both 1 and 2 (sgRNA1: TTGGAGACCGTGTCAAATAT; 407 sgRNA2: CATGCCAAGCAACAAGGTAA; sgRNA3: TAGTCGCCGTCCCCGTGGAT) were synthesized 408 Jo ur na l P re -p ro of 14 and cloned into an scAAV2 backbone vector using Kpnl and Notl (New England Biolabs), after which 409 sequence verification was performed. .. HEK293T cells with adenovirus early region 1 encoded within 410 their genome were transfected with the vector, a Plasmid Preparation:Article Title: Local gene editing of fibroblasts in tumors reveals a new cancer-associated fibroblast state Article Snippet: .. To generate NIH/3T3 cells expressing Cas9 (NIH/3T3.Cas9.EGFP), NIH/3T3 cells were lentivirally transduced with the viral supernatant produced in Lenti-X 293T cells after transfection with the following plasmids: cargo plasmid containing Cas9 and EGFP (pL-CRISPR.EFS-GFP, #57818; Addgene), VSV-G envelope–containing Article Title: New selective and allosteric FLT3 inhibitors show efficacy against resistant acute myeloid leukemia cells Article Snippet: .. psPAX2 , Addgene , Article Title: Engineered human Argonaute 2 for targeted C-to-U RNA base editing. Article Snippet: .. On day 1, cells were transfected with jetPRIME transfection reagent in a transfection mixture containing 2 μg of plasmid, 0.2 μg of Sleeping Article Title: Adult-onset deficiency of β-klotho in the liver reveals a novel role in lipid homeostasis. Article Snippet: 402 403 4.2 Adeno-associated virus generation 404 Expression cassettes encoding sgRNA sequences targeting exon 1 of Klb (sgRNA1: 405 TTACCGGCTTCTCCGGAGAC, sgRNA2: TAAAAAACAGTACGTGAGTC, sgRNA3: 406 TGCTCCGGTCCCAACGCCCC) and targeting both 1 and 2 (sgRNA1: TTGGAGACCGTGTCAAATAT; 407 sgRNA2: CATGCCAAGCAACAAGGTAA; sgRNA3: TAGTCGCCGTCCCCGTGGAT) were synthesized 408 Jo ur na l P re -p ro of 14 and cloned into an scAAV2 backbone vector using Kpnl and Notl (New England Biolabs), after which 409 sequence verification was performed. .. HEK293T cells with adenovirus early region 1 encoded within 410 their genome were transfected with the vector, a other:Article Title: Astrocytes regulate axonal mitochondrial transport deficits in C9ORF72 amyotrophic lateral sclerosis motor neurons. Article Snippet: The Laconic construct used for neuronal transduction was derived from the same Article Title: Suppression of Tau-tubulin kinase 1 mitigates tau phosphorylation, and Aβ mediated neurotoxicity via altered kinase network. Article Snippet: The target shRNA sequences were previously reported (7) and cloned into the plasmid which included Article Title: Engineering of the High-Precision Cas12m Dual Base Editor-Loaded Virus-like Particles for A-to-G and C-to-T Conversions Article Snippet: psgRNA-Cas12m was obtained based on a donor Article Title: A splicing factor-cohesin association links RNA processing to cohesin-dependent genome folding. Article Snippet: The TurboID sequence was amplified by PCR from the |